Skip to main content

Advertisement

Table 3 Primers and conditions utilized for the Quantitative RT-PCR

From: Identification of genes down-regulated during lung cancer progression: A cDNA array study

Gene Sequence PCR product (bp) Annealing Temp.
Cyc D1 for TGAGGCGGTAGTAGGACAGG 66 60°C
Cyc D1 rev GACCTTCGTTGCCCTCTGT   
VEGF for GCAGTAGCTGCGCTGATAGA 119 60°C
VEGF rev CCTTGCTGCTCTACCTCCAC   
WNT-5A for CAAAGCAACTCCTGGGCTTA 107 60°C
WNT-5A rev GCTCGGATTCCTCGGCT   
MMP11 for CAGCCAAAGAAGTCAGGACC 147 60°C
MMP11 rev GGTGCCCTCTGAGATCGAC   
Rb2/p130 for AGGAGTTTCTCCTGTGCGTATC 106 60°C
Rb2/p130 rev TGAAACAATGCTTTCTCCTCG   
Semaphorin for TCACAGTGGCAGCATAGAGG 111 60°C
Semaphorin rev TCACAGTGGCAGCATAGAGG   
Decorin for TGCAGGTCTAGCAGAGTTGTGT 91 60°C
Decorin rev AATGCCATCTTCGAGTGGTC   
XRCC1 for GACACTTACCGAAAATGGCG 110 60°C
XRCC1 rev GACACTTACCGAAAATGGCG