Skip to main content

Table 1 Primer sequence for FQPCR

From: PTEN and rapamycin inhibiting the growth of K562 cells through regulating mTOR signaling pathway

Primers Sequence Product size Accession number from genebank
BCR/ABL F : 5'- GGAGCTGCAGATGCTGACCAAC-3' 200 bp AY789120
  R : 5'- TCAGACCCTGAGGCTCAAAGT-3'   
PTEN F : 5'-ATACCAGGACCAGAGGAAACC-3' 101 bp 000314
  R : 5'-TTGTCATTATCCGCACGCTC-3'   
mTOR F : 5'- GAGCCAGTGTTCCCTCCAT-3' 128 bp NM_152756
  R : 5'- CAGTCAGCGGCCAGTCAT-3'   
CyclinD1 F : 5'-CGATGCCAACCTCCTCAACGAC-3' 143 bp NM_053056
  R : 5'-CCAGCATCCAGGTGGCGACG-3   
P27kip1 F : 5'-ACGTGAGAGTGTCTAACGG-3' 138 bp NM_004064
  R : 5'-AGTGCTTCTCCAAGTCCC-3'   
β-actin F : 5'- CTGGCACCACACCTTCTACAAT -3' 382 bp NM_001101
  R : 5'- AATGTCACGCACGATTTCCCGC -3'