Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Sequences of forward and reverse primers for real-time quantitative PCR

From: Altered gene expression and miRNA expression associated with cancerous IEC-6 cell transformed by MNNG

GeneBank no. Gene   Sequence(5'-3') Product (bp)
NM_001014786 Ifna1 Fwd GTGACCTGCCTCATACTCATAACC 443
   Rev GACTTCTGCTTTGACCACCTCCC  
NM_022197 Fos Fwd GAGAATCCGAAGGGAAAGGAATAA 252
   Rev GTCAAGTCCAGGGAGGTCACAGA  
NM_012603 Myc Fwd TCCTGTACCTCGTCCGATTCCAC 495
   Rev ACGCTTCAGCTCGTTTCTCCTCT  
NM_031334 Cdh1 Fwd GCCATCGCCTACACCATCCTCAG 282
   Rev ACGGGCACCGACCTCATTCTCAA  
NM_013135 Rasa1 Fwd CTACAACACTTGCGAGTACCTTG 276
   Rev GAACTGATTTCTGTAAACACCCATA