Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Specifice RT primer and PCR primers

From: Altered gene expression and miRNA expression associated with cancerous IEC-6 cell transformed by MNNG

Gene name RT primer PCR primers
U6 5':CGCTTCACGAATTTGCGTGTCAT F:5'GCTTCGGCAGCACATATACTAAAAT
R:5'CGCTTCACGAATTTGCGTGTCAT
rno-miR-22* 5':GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTAAAGCT GSP: 5'GGGAGTTCTTCAGTGGCA
R:5'CAGTGCGTGTCGTGGAGT
rno-miR-208 5':GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACACAAGCT GSP: 5'GGGGATAAGACGAGCAAAA
R:5'CAGTGCGTGTCGTGGAGT