Skip to main content

Advertisement

Table 2 Specifice RT primer and PCR primers

From: Altered gene expression and miRNA expression associated with cancerous IEC-6 cell transformed by MNNG

Gene name RT primer PCR primers
U6 5':CGCTTCACGAATTTGCGTGTCAT F:5'GCTTCGGCAGCACATATACTAAAAT R:5'CGCTTCACGAATTTGCGTGTCAT
rno-miR-22* 5':GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTAAAGCT GSP: 5'GGGAGTTCTTCAGTGGCA R:5'CAGTGCGTGTCGTGGAGT
rno-miR-208 5':GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACACAAGCT GSP: 5'GGGGATAAGACGAGCAAAA R:5'CAGTGCGTGTCGTGGAGT