Skip to main content

Table 1 Primer Sequences Used for Reverse Transcription-PCR and Real-time Quantitative RT-PCR (5' to 3')

From: Upregulation of CENP-H in tongue cancer correlates with poor prognosis and progression

  Gene Forward primer Reverse primer Probe
RT-PCR CENP-H TGCAAGAAAAGCAAATCGAA ATCCCAAGATTCCTGCTGTG  
  GAPDH CCACCCATGGCAAATTCCATGGCA TCTAGACGGCAGGTCAGGTCCAC  
Real-time PCR CENP-H CCTTATTTTGGGGAGTAAAGTCAAT ACAAATGCACAGAAGTATTCCAAAT FAM-TTCCTTAAGGGCAGGATCCT-TAMRA
  GAPDH GACTCATGACCACAGTCCATGC AGAGGCAGGGATGATGTTCTG FAM-CATCACTGCCACCCAGAAGACTGTG-TAMRA
  1. Full gene names: CENP-H, centromere protein H;GAPDH, glyceraldehyde-3-phosphate dehydrogenase