Skip to main content

Table 1 The sequences of the primers used in the experiment

From: The proliferation, apoptosis, invasion of endothelial-like epithelial ovarian cancer cells induced by hypoxia

Gene Sense Antisense Product (bps)
HIF1α TGCACAGGCCACATTCACGT GTTCACAAATCAGCACCAAGC 97
Flk-1 ACAGTGGTATGGTTCTTGCCTCA GTAGCCGCTTGTCTGGTTTGA 140
VEGF TCACCAAGGCCAGCACATAG GGGAACGCTCCAGGACTTAT 166
Cyclin D1 GATGCCAACCTCCTCAACGAC CTCCTCGCACTTCTGTTCCTC 171
V-src CACTCGCTCAGCACAGGACAG AGAGGCAGTAGGCACCTTTCG 196
P53 GCTGCTCAGATAGCGATGGTC CTCCCAGGACAGGCACAAACA 298
β-actin CCTGTACGCCAACACAGTGC ATACTCCTGCTTGCTGATCC 211