Skip to main content

Table 1 Reverse transcription and stem-loop primers for real-time RT-PCR

From: MicroRNAs involved in neoplastic transformation of liver cancer stem cells

Gene name Reverse transcription primer (5'-3') PCR primers (5'-3')
F: forward primer
R: reverse primer
miR-21 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAACA F: CGCGCTAGCTTATCAGACTGA
   R: GTGCAGGGTCCGAGGT
miR-10b GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCACAAA F: CGTCGTACCCTGTAGAACCGA
R: GTGCAGGGTCCGAGGT
miR-470* GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCTTCT F: GTGCGAACCAGTACCTTTCTG
R: GTGCAGGGTCCGAGGT
miR-34c-3p GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCTGGC F:GGTGGAATCACTAACCACACG
R: GTGCAGGGTCCGAGGT
let-7i* GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCAAG F: TAGTACTGCGCAAGCTACTGC
R: GTGCAGGGTCCGAGGT
miR-200a* GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCCAGC F: GAGTGCATCTTACCGGACAGT
R: GTGCAGGGTCCGAGGT
miR-148b* GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCCTGA F: GGCGCAAGTTCTGTTATACAC
R: GTGCAGGGTCCGAGGT
U6 CGCTTCACGAATTTGCGTGTCAT F: GCTTCGGCAGCACATATACTAAAAT
R: CGCTTCACGAATTTGCGTGTCAT