Skip to main content

Table 1 PCR primer sequences and product sizes.

From: Up-regulation of fas reverses cisplatin resistance of human small cell lung cancer cells

Primersa Oligonucleotide Sequences Product Size (bp) PCR Cycles
Fas F: 5'GTCCAAAAGTGTTAATGCCCAAGT 3' 232 30
  R: 5'ATGGGCTTTGTCTGTGTACTCCT 3'   
GST-π F: 5' CCGCCCTACACCGTGGTCTAT 3' 260 30
  R: 5' GCTGCCTCCTGCTGGTCCTT 3'   
ERCC1-2 F: 5' ACGCCGAATATGCCATCTCAC 3' 292 30
  R: 5' AGCCGCCCATGGATGTAGTCT 3'   
GAPDH F: 5' ACCCATCACCATCTTCCAGGAG 3' 159 30
  R: 5' GAAGGGGCGGAGATGATGAC 3'   
  1. a All primers were designed using genetool software.