Skip to main content

Table 1 Primers' sequences employed in the specific-PCR

From: Presymptomatic breast cancer in Egypt: role of BRCA1 and BRCA2 tumor suppressor genes mutations detection

Primers Sequence (5'- 3')
BRCA1
Exon 2
Sense: GAAGTTGTCATTTTATAAACCTTT
Antisense: GTCTTTTCTTCCCTAGTATGT
BRCA1
Exon 8
Sense: TGTTAGCTGACTGATGATGGT
Antisense: ATCCAGCAATTATTATTAAATAC
BRCA1
Exon 13
Sense: AATGGAAAGCTTCTCAAAGTA
Antisense: ATGTTGGAGCTAGGTCCTTAC
BRCA1
Exon 22
Sense: ATG TTG GAG CTA GGT CCT TAC
Antisense: GAG AAG ACT TCT GAG GCT ACG
BRCA2
Exon 9
Sense: CAT CAC ACT ACT CAG GAT GAC A
Antisense: GCA TGG TGG TGC ATG CTT GTA