Skip to main content

Table 2 Sequencing data of exon 22 of BRCA1 gene which amplified from healthy woman (control) and patient with breast cancer, the alignment was carried out using Clustal W 1.9 program.

From: Presymptomatic breast cancer in Egypt: role of BRCA1 and BRCA2 tumor suppressor genes mutations detection

Subject Nucleotide sequence Number
Control TGAAACCTGCCCTAATAATTCAGTCATCTCTCAGGATCTTGATTATAAAGAAGCAAAATG 60
Patient TGAAACCTACCTTTATAACTTAGTCCAATCTCTAGATTTTGATTTTAAAGAAACAAATAG
******** ** * **** * **** **** *** ****** ******* **** *
60
Control TAATAAGGAAAAACTACAGTTATTTATTACCCCAGAAGCTGATTCTCTGTCATGCCTGCA 120
Patient TAATAAGGAAAAACTACAGTTATTTATTACCCCAGAAGCTGATTCTCTGTCATGCCTGCA
************************************************************
120
Control GGAAGGACAGTGTGAAAATGATCCAAAAAGCAAAAAAGTTTCAGATATAAAAGAAGAGGT 180
Patient GGAAGGACAGTGTGAAAATGATCCAAAAAGCAAAAAAGTTTCAGATATAAAAGAAGAGGT
************************************************************
180