Skip to main content

Table 3 Sequencing data of exon 9 of BRCA2 gene which amplified from healthy woman (control) and patient with breast cancer, the alignment was carried out using Clustal W 1.9 program.

From: Presymptomatic breast cancer in Egypt: role of BRCA1 and BRCA2 tumor suppressor genes mutations detection

Subject Nucleotide sequence Number
Control
Patient
ATCACACTTCTCAGGATGACCCATCAGGTATTCTGATTCACCAAAGCGACTCATGGATAA
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ATCACACTTCTCAGGATGACCCATCAGGTATTCTGATTCACCAAAGCGACTCATGGATAA
1-60
1-60
Control
Patient
GGGGGGACTACTACTATATGTGCATTGAGAGTTTTTATACTAGTGATTTTAAACTATAAT
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GGGGGGACTACTACTATATGTGCATTGAGAGTTTTTATACTAGTGATTTTAAACTATAAT
61-120
61-120
Control
Patient
TTTTGCAGAATGTGAAAAGCTATTTTTCCAATCATGATGAAAGTCTGAAGAAAAATGATA
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TTTTGCAGAATGTGAAAAGCTATTTTTCCAATCATGATGAAAGTCTGAAGAAAAATGATA
121-180
121-180
Control
Patient
GATTTATCGCTTCTGTGACAGACAGTGAAAACACAAATCAAAGAGAAGCTGCAAGTCATG
|||||||||||||||||||||||||||||||||||||     ||||||||||||||||||
GATTTATCGCTTCTGTGACAGACAGTGAAAACACAAA-----GAGAAGCTGCAAGTCATG
181-240
181-235
Control
Patient
GTAAGTCCTCTGTTTAGTTGAACTACAGGTTTTTTTGTTGTTGTTGTTTTGATTTTT
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GTAAGTCCTCTGTTTAGTTGAACTACAGGTTTTTTTGTTGTTGTTGTTTTGATTTTT
241-297
236-292