Skip to main content

Table 1 the nested primer

From: A comparison of ARMS and direct sequencing for EGFR mutation analysis and Tyrosine Kinase Inhibitors treatment prediction in body fluid samples of Non-Small-Cell Lung Cancer patients

  Sense Antisense
19 exon outer AAATAATCAGTGTGATTCGTGGAG GAGGCCAGTGCTGTCTCTAAGG
19 exon inner GTGCATCGCTGGTAACATCC TGTGGAGATGAGCAGGGTCT
21 exon outer GCAGCGGGTTACATCTTCTTTC CAGCTCTGGCTCACACTACCAG
21 exon inner GCTCAGAGCCTGGCATGAA CATCCTCCCCTGCATGTGT