Skip to main content


Table 2 Primer sequence for real-time pcr

From: Folic Acid supplementary reduce the incidence of adenocarcinoma in a mouse model of colorectal cancer: microarray gene expression profile

Gene name Forward sequence Reverse sequence Product
Tpd52 tctaaagtaggaggagccaagc gctctctgtcatctgttctgga 117
DNMT1 caagaagaaaggcaaggtcaac cctggatgctctcaagtaggtc 212
c-Myc atttctatcaccagcaacagcag aacataggatggagagcagagc 137
K-RAS tggtcctggtagggaataagtg cccatctttgctcatcttttct 191
CDKN1b cttgcccgagttctactacagg agagtttgcctgagacccaat 127
Tnfrsf12a cgaccacacagcgacttct ccaaaaccaggaccagactaag 106
VDR tgaaggagttcatcctcacaga gataatgtgctgttgctcctca' 128
18S rRNA cggacaggattgacagattgatagc tgccagagtctcgttcgttatcg 150