Skip to main content

Table 2 Sequences of primers

From: Plasma levels of leptin and soluble leptin receptor and polymorphisms of leptin gene -18G > A and leptin receptor genes K109R and Q223R, in survivors of childhood acute lymphoblastic leukemia

Genetic polymorphism Sequences of primers Genotyping method used (restriction enzyme)
Leptin gene - 18G > A tggagccccgtaggaatcgca
tgggtctgacagtctcccaggga
PCR-RFLP (Aci I)
Leptin receptor gene - K109R tttccactgttgctttcgga
aaactaaagaatttactgttgaaacaaatggc
PCR-RFLP (Hae III)
Leptin receptor gene - Q223R aaactcaacgacactctcctt
tgaactgacattagaggtgac
PCR-RFLP (Msp I)