Skip to main content

Table 2 Primers of genes

From: Overexpression of DNA damage-induced 45 α gene contributes to esophageal squamous cell cancer by promoter hypomethylation

Gene primers
GADD45α, PF:5'-GCCTGTGAGTGAGTGCAGAA-3',
  RF: 5'-CCCCACCTTATCCATCCTTT-3'
GADD45β PF:5'-TCGGCCAAGTTGATGAATG-3':
  RF: 5'-CAGAAGGACTGGATGAGCGT-3'
GADD45γ PF:5'-CGTCTACGAGTCAGCCAAAG-3'
  RP:5'-GCCTGGATCAGCGTAAAAT-3'
β-ACTIN PF:5'GCACCACACCTTCTACAATGAGC'3
  RP:5'GGATAGCACAGCCTGGATAGCAAC'3