Skip to main content

Table 1 PCR primers used in the experiments

From: Response gene to complement-32 enhances metastatic phenotype by mediating transforming growth factor beta-induced epithelial-mesenchymal transition in human pancreatic cancer cell line BxPC-3

Target mRNA Primer sequences 5'-3' Product Size
(bp)
Gene Bank Accession No
RGC-32 sense TGCCAGAGGGGACAAAGAC 127 NM_014059.2
RGC-32 antisense GCAAGCAGGTAAACAAAGTCAG   
E-cadherin sense ACAGCCCCGCCTTATGATTCTC 140 NM_004360.3
E-cadherin antisense AAGCGATTGCCCCATTCGTT   
vimentin sense CCTTGAACGCAAAGTGGAATC 106 NM_003380.3
vimenin antisense GACATGCTGTTCCTGAATCTGAG   
β-actin sense GTTGCGTTACACCCTTTCTTG 157 NM_001101.3
β-actin antisense GACTGCTGTCACCTTCACCGT