Clinical significance of stanniocalcin-1 detected in peripheral blood and bone marrow of esophageal squamous cell carcinoma patients

Table 1 List of the nested PCR primers

Primers	Sequences (5′-3′)	Products	PCR conditions
STC-1 (outer)	CTTCACTCAAGCCAGGAGAGGGAAAGAGGAAA	890 bp	94°C for 30s, 62°C for 30s, 72°C for 1 min, 40 cycles
STC-1 (outer)	TGGTGTGTCAACACCCCTAAAATGATA	890 bp	94°C for 30s, 62°C for 30s, 72°C for 1 min, 40 cycles
STC-1 (inner)	GTGGCGGCTCAAAACTCAGCTGAA	645 bp	94°C for 30s, 60°C for 30s, 72°C for 1 min, 40 cycles
STC-1 (inner)	TTATGCACTCTCATGGGATGTGCGTT	645 bp	94°C for 30s, 60°C for 30s, 72°C for 1 min, 40 cycles
β-actin	CCCTGGACTTCGAGCAAGAGAT	531 bp	94°C for 30s, 55°C for 30s, 72°C for 1 min, 35 cycles
β-actin	GTTTTCTGCGCAAGTTAGG	531 bp	94°C for 30s, 55°C for 30s, 72°C for 1 min, 35 cycles

ISSN: 1756-9966