Skip to main content

Advertisement

Table 1 Sequences of the primers used for qPCR of transcripts coding for SGK1 (all four isoforms), for each of the four isoforms and for glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

From: Determination of SGK1 mRNA in non-small cell lung cancer samples underlines high expression in squamous cell carcinomas

Gene Symbol Accession Number Sense Primer Antisense Primer
SGK1 (all 4 isoforms) N/A AGGGCAGTTTTGGAAAGGTT CTGTAAAACTTTGACTGCATAGAACA
SGK1 (isoform 1) NM_005627.3 GGCACCCTCACTTACTCCAG GGCAATCTTCTGAATAAAGTCGTT
SGK1 (isoform 2) NM_001143676.1 CGGTGGAAAATGGTAAACAAA CTTGATCCACCTTCGTACCC
SGK1 (isoform 3) NM_001143677.1 GAAGCTATAAAACCCCCTTTGAA GGCAATCTTCTGAATAAAGTCGTT
SGK1 (isoform 4) NM_001143678.1 CTTCCTGCTGAGCGGACT GGCAATCTTCTGAATAAAGTCGTT
GAPDH NM_002046 AGCCACATCGCTCAGACA GCCCAATACGACCAAATCC