Skip to main content

Table 2 The sequence of synthetic primers of PCR, RT and single-stranded miRNAs

From: Plasma specific miRNAs as predictive biomarkers for diagnosis and prognosis of glioma

miRNA ID Primer and miRNA sequence
  RT GTCGTATCCAGTGCAGGGTCCGAG
GTGCACTGGATACGACTCAACATC
hsa-miRNA-21 Forward primer TGCGGTAGCTTATCAGACTGATG
  Reverse primer CCAGTGCAGGGTCCGAGGT
  RT GTCGTATCCAGTGCAGGGTCCGAG
GTGCACTGGATACGACAAAGAGAC
hsa-miRNA-128 Forward primer TGCGGTCACAGTGAACCGGTCTC
  Reverse primer CCAGTGCAGGGTCCGAGGT
  RT GTCGTATCCAGTGCAGGGTCCGAG
GTGCACTGGATACGACACGGGTG
hsa-miRNA-342-3P Forward primer TGCGGTCTCACACAGAAATCGCAC
  Reverse primer CCAGTGCAGGGTCCGAGGT
  RT GTCGTATCCAGTGCAGGGTCCGAG
GTGCACTGGATACGACACTCACC
hsa-miRNA-181a Forward primer TGCGGAACATTCAACGCTGTCGG
  Reverse primer CCAGTGCAGGGTCCGAGGT
  RT GTCGTATCCAGTGCAGGGTCCGAG
GTGCACTGGATACGACACCCACC
hsa-miRNA-181b Forward primer TGCGGAACATTCATTGCTGTC
  Reverse primer CCAGTGCAGGGTCCGAGGT
  RT GTCGTATCCAGTGCAGGGTCCGAG
GTGCACTGGATACGACACTCACC
hsa-miRNA-181C Forward primer TGCGGAACATTCAACCTGTCGG
  Reverse primer CCAGTGCAGGGTCCGAGGT
  RT GTCGTATCCAGTGCAGGGTCCGAG
GTGCACTGGATACGACTGTAAAC
hsa-miRNA-15b Forward primer TGCGGTAGCAGCACATCATGGTTTAC
  Reverse primer CCAGTGCAGGGTCCGAGGT
  RT GTCGTATCCAGTGCAGGGTCCGAG
GTGCACTGGATACGACGAAACC
hsa-miRNA-221 Forward primer TGCGGAGCTACATTGTCTGCTGG
  Reverse primer CCAGTGCAGGGTCCGAGGT
  RT GTCGTATCCAGTGCAGGGTCCGAG
GTGCACTGGATACGACACCCAG
hsa-miRNA-222 Forward primer TGCGGAGCTACATCTGGCTACTG
  Reverse primer CCAGTGCAGGGTCCGAGGT
  RT GTCGTATCCAGTGCAGGGTCCGAG
GTGCACTGGATACGACAGACTCA
mmu-miRNA-295 Forward primer TGCGGAAAGTGCTACTACTTTTG
  Reverse primer CCAGTGCAGGGTCCGAGGT
mmu-miRNA-295 RNA AAAGUGCUACUACUUUUGAGUCU