Skip to main content

Table 1 Primer sequences used qRT-PCR

From: A novel miR-219-SMC4-JAK2/Stat3 regulatory pathway in human hepatocellular carcinoma

  Forward primer Reverse primer
SMC4 5'-GAGAAAATTCTGGGACCTTT-3' 5'-TCTGAATGTCCTTGTGTTCA-3'
β-actin 5'-CATTAAGGAGAAGCTGTGCT-3' 5'-GTTGAAGGTAGTTTCGTGGA-3'
mir-219 5'- TGATTGTCCAAACGCA -3' 5'- TTTGGCACTAGCACATT -3'
U6 5'- CTCGCTTCGGCAGCACA -3' 5'- AACGCTTCACGAATTTGCGT -3'
JAK2 5'- AGCCTATCGGCATGGAATATCT -3' 5'- TAACACTGCCATCCCAAGACA -3'
STAT3 5'- ACCAGCAGTATAGCCGCTTC -3' 5'- GCCACAATCCGGGCAATCT -3'
β-actin 5'- CATTAAGGAGAAGCTGTGCT-3' 5'- GTTGAAGGTAGTTTCGTGGA -3'