Skip to main content

Table 1 Sequence of primers used in qRT-PCR and constructs

From: The role of microRNA-133b and its target gene FSCN1 in gastric cancer

Primer Sequence (5′ → 3′)
miR-133b-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAGCAGG
miR-133b-forward CTGGAGTTTGGTCCCCTTCAAC
miR-133b-reverse GTGCAGGGTCCGAGGT
miR-133b-probe FAM-ATACGACTAGCAGGTTGA-MGB
U6-RT AAAATATGGAACGCTTCACGAATTTG
U6-forward CTCGCTTCGGCAGCACATATACT
U6-reverse ACGCTTCACGAATTTGCGTGTC
U6-probe FAM-CCATGCTAATCTTCTCTGTA-MGB
FSCN1-UTR-F TGGGCTAGGACTGACCCTTGT
FSCN1-UTR-R GGGAGCACCAATCACAGCA
FSCN1-UTR-Mut Sense GAAAATCGCTCATTCAGTATTT
FSCN1-UTR-Mut Anti TACTGAATGAGCGATTTTCTGCTT