Skip to main content

Table 1 Primer sequences for RT-PCR

From: Hypoxia-inducible MiR-182 promotes angiogenesis by targeting RASA1 in hepatocellular carcinoma

Name Sense strand Anti-sense strand
GAPDH GTCTCCTCTGACTTCAACAGCG ACCACCCTGTTGCTGTAGCCAA
RASA1 GGGACATCCAATAAACGCCTTCG TTTGCTACTTGGACACTATTCAGG