Therapeutic potential of antiviral drugs targeting chemorefractory colorectal adenocarcinoma cells overexpressing endogenous retroviral elements

Table 1 Real Time PCR primers used for the detection of HERVs. The accession, region, sequence, polarity and product size for the primers used are reflected

Symbol	Accession	Region	Forward	Reverse	Size _(bp)
18S	NR003286	1025-1513	tcaagaacgaaagtcggagg	ggacatctaagggcatcaca	488
HERV-W_E1	AF072506	290-463	gggttccatggttctcttct	tggtgaaccacttccaagat	174
HERV-FRD₁	NM207582	504-698	ctcattctcacgccttcact	taattccgcctctatgcttg	195
HERV-V₁	NM152473	1565-1757	gggcaaagattctgcaacta	ttgtctggctacctgcctac	193
HERV-3₁	NM001007253	1377-1562	taaccagaaattgcctgagc	gaagaggcggttagtgtgaa	186

ISSN: 1756-9966