Skip to main content

Table 1 Real Time PCR primers used for the detection of HERVs. The accession, region, sequence, polarity and product size for the primers used are reflected

From: Therapeutic potential of antiviral drugs targeting chemorefractory colorectal adenocarcinoma cells overexpressing endogenous retroviral elements

Symbol Accession Region Forward Reverse Size (bp)
18S NR003286 1025-1513 tcaagaacgaaagtcggagg ggacatctaagggcatcaca 488
HERV-WE1 AF072506 290-463 gggttccatggttctcttct tggtgaaccacttccaagat 174
HERV-FRD1 NM207582 504-698 ctcattctcacgccttcact taattccgcctctatgcttg 195
HERV-V1 NM152473 1565-1757 gggcaaagattctgcaacta ttgtctggctacctgcctac 193
HERV-31 NM001007253 1377-1562 taaccagaaattgcctgagc gaagaggcggttagtgtgaa 186