Skip to main content

Table 1 Primers for amplification of cHAb18 and identification of rNDV-18HLa

From: Oncolytic Newcastle disease virus expressing chimeric antibody enhanced anti-tumor efficacy in orthotopic hepatoma-bearing mice

Primer names Sequences (5' - 3')
18 L-F TTAGAAAAAAATACGGGTAGAAATAAGCCACCATGGACTCACATACTC
18 L-R TATTCCGGATTAACACTCTCCCCTGTTGAA
18H-F ATATCCGGAGCCACCATGAACTTCGGGCTGAGC
18H-R TTCTACCCGTATTTTTTTCTAAGTGATAGTGATCATTTACCCGGAGAC
VT-F GACGGGATAACTCTGAGG
VT-R GTATGCCAACAAGGTCGC
  1. aUnderline indicated the overlap regions in overlap PCR