Skip to main content

Table 1 Primer sequences for real-time PCR

From: TET3 inhibits TGF-β1-induced epithelial-mesenchymal transition by demethylating miR-30d precursor gene in ovarian cancer cells

Genes primer sequences (5′-3′) Length of PCR product (bp)
TET1 F: CCCGAATCAAGCGGAAGAATA 101
R: TACTTCAGGTTGCACGGT
TET2 F: CTTTCCTCCCTGGAGAACAGCTC 146
R: TGCTGGGACTGCTGCATGACT
TET3 F: GTTCCTGGAGCATGTACTTC 93
R: CTTCCTCTTTGGGATTGTCC
β-actin F: TCCCTGGAGAAGAGCTACGA 194
R: AGCACTGTGTTGGCGTACAG