Skip to main content

Table 1 Primers and probes for qPCR

From: Decreased brain-expressed X-linked 4 (BEX4) expression promotes growth of oral squamous cell carcinoma

Name Forward primer (5’-3’) Reverse primer (5’-3’) Probe numbera
BEX1 CACCTCGTGGCGAGAATC CTCTTTGGACTCCATTACTCCTG 63
BEX2 TCCTGAGGCTACGACCTTTC CGATTCTCGACGTGAGGTG 16
BEX3 CTTCGGTGCAGTCGTCACT ACACTTAGCCTCGCAGACCT 24
BEX4 GCCCCGAAATTAGGAAGC TGTTTGCCGCTAGTTCCTCT 15
BEX5 GCCGATTTCAAGGCTAAGAG GGACATTTTCCATGTTGAGTTTTT 34
RSAD2 CACGTAAACTAGATCAGGGAACAA TCAACAAACTGCATGGGATATT 55
S100A9 CTCCCACGAGAAGATGCAC GAGGCCTGGCTTATGGTG 81
IFI6 AACCGTTTACTCGCTGCTGT GGGCTCCGTCACTAGACCTT 40
PTPRZ1 GGCCTGTTGTCGTCCACT TCTGCTGCAACATACTGTCTAGC 67
MS4A4A GGAATTCTGCATTGCTGTGTC TGATGGCAGAATTAACACAACC 13
FABP5 GAGTGGGATGGGAAGGAAAG GATCCGAGTACAGGTGACATTG 22
S100A7 CCAAACACACACATCTCACTCA TCAGCTTGAGTGTTGCTCATC 33
S100A8 GCCAAGCCTAACCGCTATAA ATGATGCCCACGGACTTG 34
SPRR1B CAGAGTATTCCTCTCTTCACACCA CAAGGCTGTTTCACCTGCT 3
S100A12 CACATTCCTGTGCATTGAGG GGTGTCAAAATGCCCCTTC 31
S100A7A CATAGCCGCAGACTACCACA ACTGGCTTCCCCCAGAAC 21
SPRR1A AGCCCAAGGTTCCAGAGC TTCTGCTTGGTCTTCTGCTG 67
IFI44 AGCCTGTGAGGTCCAAGCTA GAACATCCTTTACAGGGTCCAG 6
PGLYRP3 CCCCACTCCCTTTGAGACT CTTGGCTGGTGAGGGTTG 3
IL1R1 GTCTCTGCTCTTGCCTCGAC TCAGCTAGAGAAAATGCGAGAA 63
CBX5 AGAAGATGAAGGAGGGTGAAAA GCGATATCATTGCTCTGCTCT 7
PTX3 TGTATGTGAATTTGGACAACGAA CATTCCGAGTGCTCCTGAC 58
PADI3 CAGCAATGACCTCAACGACA GAGGTAGAGCACCGCATAGG 19
ANKRD22 CAGTGCCTTTGTTTCATTGG CACCTGTCAGTGCTTTTCCA 74
LIF TGCCAATGCCCTCTTTATTC GTCCAGGTTGTTGGGGAAC 26
TMEM156 CATGGAATACCCGAATGATTG CCAAGTGATCTTCATGGAACAA 80
GPRC5B CCGCAGAGATGTGACTCG GATGCCACGAACATTCGAC 78
FTH1 GCCAGAACTACCACCAGGAC CATCATCGCGGTCAAAGTAG 1
SLC6A15 AAAGTGGGGGCTTAAACTGG CATAGCCAAGCAAACCATGA 27
SLITRK6 GAAGAAAAAGAAACTCAGGGATCA GGACAGACTAAATTGCCTGAAGA 7
PLLP CACCCGGCCTTATAACCAG AAGGCACTCACTCCATAGGC 9
  1. aUniversal ProbeLibrary