Skip to main content

Table 2 Primers sequences used in sgBRCA1 cloning and knockout validation

From: Transfer of malignant trait to BRCA1 deficient human fibroblasts following exposure to serum of cancer patients

Primer Sequence (5’-3’) Purpose
sgBRCA1a CACCGTGGTCACACTTTGTGGAGAC
AAACGTCTCCACAAAGTGTGACCAC
Single-guide cloning
hU6_Seq ACTATCATATGCTTACCGTAAC Primer for sequencing
BRCA1-F TAGGGGTGGATATGGGTGAA Surveyor assay
BRCA1-R GTTGCAGTGAGCCAAGATCA Surveyor assay
  1. aThese oligos were annealed to make the double-stranded linker with sticky ends (underlined nucleotides)