Skip to main content

Table 1 Premier sequences and product sizes

From: Spheres derived from the human SN12C renal cell carcinoma cell line are enriched in tumor initiating cells

Genes Sense primers Antisense primers Products (bp)
β-Actin 5′- CGGGAAATCGTGCGTGAC -3′ 5′- GAAGGAAGGCTGGAAGAGTG -3′ 183 bp
CD44 5′- AATCCCTGCTACCACTTT -3′ 5′- TTTCTTCATTTGGCTCCC -3′ 191 bp
CD133 5′- TTACGGCACTCTTCACCT -3′ 5′- TATTCCACAAGCAGCAAA -3′ 172 bp
CD105 5′- TTTGGTGCCTTCCTCATCG -3′ 5′- GGTTGGTGCTGCTGCTCT -3′ 136 bp
Nanog 5′- CCTATGCCTGTGATTTGT -3′ 5′- GTTGTTTGCCTTTGGGAC -3′ 160 bp
OCT4 5′- GGTTCTATTTGGGAAGGTGTT -3′ 5′- TGCTGGGCGATGTGGCTGA -3′ 279 bp
CD31 5′- GCCAACTTCACCATCCAG -3′ 5′- CACCCTCAGAACCTCACTTA -3′ 420 bp
CD34 5′- TTGCTGCCTTCTGGGTTC -3′ 5′- CATTTGATTTCTGCCTTGAT -3′ 458 bp