Skip to main content

Table 1 Primer sequences used in quantitative real-time PCR

From: Regulation of TRIM24 by miR-511 modulates cell proliferation in gastric cancer

Gene Primers
miR-511 forward: 5′- AGTGCTGGTGTCTTTTGCTCTG -3′
reverse: 5′- TATGGTTGTTCACGAGTCCTTCAC -3′
TRIM24 forward: 5′- CATATGCAGCAACAGCAACCG -3′
reverse: 5′- GAAAGCCATCTGTAGGGGGT -3′
U6 forward: 5′- AGAGCCTGTGGTGTCCG -3′
reverse: 5′- CATCTTCAAAGCACTTCCCT -3′
GAPDH forward: 5′-CATCACCATCTTCCAGGAGCG-3
reverse: 5′-TGACCTTGCCCACAGCCTTG-3′