Skip to main content

Table 1 Primers for PCR used in this study

From: Pro-inflammation NF-κB signaling triggers a positive feedback via enhancing cholesterol accumulation in liver cancer cells

Gene Name Forward primer (5′ → 3′) Reverse primer (5′ → 3′)
PCSK9 AGACCCACCTCTCGCAGTC GGAGTCCTCCTCGATGTAGTC
LDLR GCTACCCCTCGAGACAGATG CACTGTCCGAAGCCTGTTCT
SREBF2 GGTTGTCGGGTGTCATGGG TTGCAGCATCTCGTCGATGT
HMGCR GAGCGTGCGTAAGGTGAGG ACAGAATCCTTGGATCCTCCAG
IKKα GGCTTCGGGAACGTCTGTC TTTGGTACTTAGCTCTAGGCGA
TAB3 AGCAGCCCACAGCTTGATATT ACTAGGAGAATGGATACCCAGGT
MiR-195 GTCATTCCCTATTTCTTCTGCC ATTGGACCATCTTCCCTCTGT
VCAM1 GGGAAGATGGTCGTGATCCTT TCTGGGGTGGTCTCGATTTTA
MMP9 GGAGGTTCGACGTGAAGG GGAACATCCGGTCCACCT
IL8 AGACAGCAGAGCACACAAGC ATGGTTCCTTCCGGTGGT
TNFα CTCGAACCCCGAGTGACAA GCTGCCCCTCAGCTTGAG
IκBα CATTGACATCAGCACCCAAG CCACTCCATCCTGAAGGCTA
P100 CTCCTCTAGGCCCATGTCAG AGCCTGGTAGACACGTACCG
β-actin CGTGGACATCCGTAAAGACC ACATCTGCTGGAAGGTGGAC