Skip to main content

Table 1 Primer sequences used in real-time PCR experiments

From: Cancer cells increase endothelial cell tube formation and survival by activating the PI3K/Akt signalling pathway

Gene name Primer sequence (5' → 3')
ACTN1 Forward: AACTGTCACTTGGCGGGCAGGG
Reverse: AAGGGCATCAGCCAGGAGCAGAT
AKT3 Forward: CCTTCCAGACAAAAGACCGTTT
Reverse: ATGTAGATAGTCCAAGGCAGAGACAA
CTNNB1 Forward: AGCTAAAATGGCAGTGCGTTTAG
Reverse: ACTAGCCAGTATGATGAGCTTGCTT
CXCL8 Forward: TTGGCAGCCTTCCTGATTTC
Reverse: AACTTCTCCACAACCCTCTGCA
ICAM1 Forward: CGATGACCATCTACAGCTTTCCGG
Reverse: GCTGCTACCACAGTGATGATGACAA
ITGAV Forward: CTTCCAATTGAGGA ATCACCAACT
Reverse: CAATCCTGCTAGAACTGCTAAAATGA
ITGB3 Forward: CGACCGAAAAGAATTCGCTAAA
Reverse: GGTACGTGATATTGGTGAAGGTAGAC
PIK3CA Forward: AACACTCAAAGAGTACCTTGTTCCAA
Reverse: TAGCACCCTTTCGGCCTTTA
PIK3R1 Forward: GCGAGATGGCACTTTTCTTGT
Reverse: TACTTCGCCGTCCACCACTAC
PIK3R3 Forward: GATGCCCTATTCGACAGAACTGA
Reverse: TTGGAACTGCTGAAGTCATTGG
PTGS2 Forward: CCCTTGGGTGTCAAAGGTAA
Reverse: GCCCTCGCTTATGATCTGTC
RAC1 Forward: AAGCTGACTCCCATCACCTATCCG
Reverse: CGAGGGGCTGAGACATTTACAACA
VCAM1 Forward: GGGAAGATGGTCGTGATCCTT
Reverse: TCTGGGGTGGTCTCGATTTTA