Skip to main content

Table 1 Primer sequences of genes

From: Notch signaling plays a crucial role in cancer stem-like cells maintaining stemness and mediating chemotaxis in renal cell carcinoma

Gene Primer sequence
CTR2 F: 5′- TCCAGGTAGTCATCAGCT -3′
R: 5′- TGGCAGTGCTCTGTGATGTC -3′
BCL-2 F: 5′- CTCCTGACGCTAAGAGCTTCG -3'
R: 5′- CCAGGCTGGAAGGGAAAGAC -3′
MDR1 F: 5′- GGAAGACATGACCAGGTATGC -3′
R: 5′- GCACATCAAACCAGCCTATCTC -3′
OCT-4 F: 5′- TTCAGCCAAACGACCATCT -3′
R: 5′- GCTTTGCATATCTCCTGAAGA -3′
KLF4 F: 5′- CCCACATTAATGAGGCAGC -3′
R: 5′- AGTCGCTTCATGTGGGAGAG -3′
Notch1 F: 5′- CCCGCCAGAGTGGACAGGTCAGTA -3′
R: 5′- TGTCGCAGTTGGAGCCCTCGTTA -3′
Notch2 F: 5′- CCCACAATGGACAGGACA -3′
R: 5′- GAGGCGAAGGCACAATCA -3′
Notch3 F: 5′- TCTCAGACTGGTCCGAATCCAC -3′
R: 5′- CCAAGATCTAAGAACTGACGAGCG -3′
Jagged1 F: 5′- GACACCGTTCAACCTGACAGTATTA -3′
R: 5′- GTCACAGGCATAGTGTCCAAAGA -3′
Jagged2 F: 5′- TCGGGCAGGAACTGTGAGAAGGC -3′
R: 5′- AATCACAGTAATAGCCGCCAATCAGGT -3′
DLL1 F: 5′- AGGGGTGGAGAAGCATCTGAAA -3′
R: 5′- AACCTGCTCGGTCTGAACTCG -3′
DLL3 F: 5′- ACGCCTGGCCTGGCACCTT -3′
R: 5′- CCCTCTAGGCATCGGCATTCACC -3′
DLL4 F: 5′- ACAGTGAAAAGCCAGAGTGTCGG -3′
R: 5′- TGAGCAGGGATGTCCAGGTAGG -3′
β-actin F: 5′- AGGGGCCGGACTCGTCATACT -3′
R: 5′- GGCGGCACCACCATGTACCCT -3′
Vimentin F: 5′- CTTCCGCGCCTACGCCA -3′
R: 5′- GCCCAGGCGAGGTACTCC -3′
Hey1 F: 5′- CATACGGCAGGAGGGAAAG -3′
R: 5′- GCATCTAGTCCTTCAATGATGCT -3′
Hes1 F: 5′- AGTGAAGCACCTCCGGAAC -3′
R: 5′- CGTTCATGCACTCGCTGA -3′