Skip to main content

Table 1 Primers used for the qRT-PCR analysis

From: Sex-determining region Y-box protein 3 induces epithelial-mesenchymal transition in osteosarcoma cells via transcriptional activation of Snail1

genes Sequence (5’-3’)
Forward primer Reverse primer
SOX3 GACCTGTTCGAGAGAACTCATCA CGGGAAGGGTAGGCTTATCAA
E-cadherin CGAGAGCTACACGTTCACGG GGGTGTCGAGGGAAAAATAGG
CK-18 GGCATCCAGAACGAGAAGGAG ATTGTCCACAGTATTTGCGAAGA
N-cadherin TCAGGCGTCTGTAGAGGCTT ATGCACATCCTTCGATAAGACTG
Vimentin GACGCCATCAACACCGAGTT CTTTGTCGTTGGTTAGCTGGT
Snail1 AAGGCCTTCTCTAGGCCCT CGCAGGTTGGAGCGGTCAG
Snail2 TTCGGACCCACACATTACCT GCAGTGAGGGCAAGAAAAAG
Twist1 CAGCTACGCCTTCTCGGTCT CTGTCCATTTTCTCCTTCTCTGGA
Zeb1 GATGATGAATGCGAGTCAGATGC ACAGCAGTGTCTTGTTGTTGT
Zeb2 CAAGAGGCGCAAACAAGCC GGTTGGCAATACCGTCATCC
Snail1 promoter TCAGAAGCGCTCAGACCAC TTATCTGCCACGCCCCTTT
Snail1 non-promoter TGCTCATCTGGGACTCTGTC GAGGAGAAGGACGAAGGAGC
β actin TTGCCGACAGGATGCAGAAG CAGCGAGGCCAGGATGGAGC