Skip to main content

Table 1 Primers for Methylation Specific PCR of NF2

From: Regulation of human glioma cell apoptosis and invasion by miR-152-3p through targeting DNMT1 and regulating NF2

Primers Sequence(5′- 3′) Product Length(bp)
NF2-M F TGCGTTGAAATTTAATAATTTTACG 303
NF2-M R CCAAACTAAAATACAATAACGCGAT  
NF2-UF TGTGTTGAAATTTAATAATTTTATGA 303
NF2-UR CCAAACTAAAATACAATAACACAAT