Skip to main content

Table 1 Primer Sequences and Reaction Properties

From: Combination therapy of PKCζ and COX-2 inhibitors synergistically suppress melanoma metastasis

Target   Sequence Product Size (bp) Annealing temp. (°C)
Human     
PKCζ forward CTGAGGAGCACGCCAGGTT 625 58.1
reverse ACGGGCTCGCTGGTGAACT
COX-2 forward TCTGCAGAGTTGGAAGCA-CTCTA 216 58.4
reverse GCCGAGGCTTTTCTACCAGAA
β-actin forward CTGGCACCCAGCACAATG 458 54.1
reverse GCCGATCCACACGGAGTACT
Mouse     
PKCζ forward ACGGACAACCCTGACATGAAC 361 57.1
reverse ATTCGGACTGGTCGATCCTCT
COX-2 forward TCAGGTCATTGGTGGAGAGG 96 54
reverse GCAAACTGCAGGTTCTCAGG
β-actin forward ATGGAGCCACCGATCCACA 426 56.2
reverse CATCCGTAAAGACCTCTATGCCAAC