Skip to main content

Table 1 The primer and probe for detecting the 3′/5′ portion of ALK gene with RT-qPCR

From: 5′/ 3′ imbalance strategy to detect ALK fusion genes in circulating tumor RNA from patients with non-small cell lung cancer

Gene Exon Primer(5′ → 3′) Located on cDNA Amplicon length
ALK E20 Forward: CGGCATCATGATTGTGTACC 3159~ 3178 145 bp
Reverse: CTTGCCAGCAAAGCAGTAG 3285~ 3303
Probe: FAM-CTGAGCAAGCTCC-MGB 3238~ 3303
E3 Forward: CAGCCGATATGGTCTGGAG 777~ 795 168 bp
Reverse: ATCTCCTTAGAACGCTCTGC 925~ 944
Probe: VIC-TCCCCTCCACTGCAT-MGB 829–843
ACTB E3 Forward: CAGGCACCAGGGCGTGAT 114~ 131 134 bp
Reverse: CCATGTCGTCCCAGTTGGT 229~ 247
Probe: NED-ACGAGGCCCAGAGCA-MGB 167~ 181