Skip to main content

Table 2 Sequences of primers used for quantitative real-time PCR assays

From: Overexpression of the Kininogen-1 inhibits proliferation and induces apoptosis of glioma cells

Gene Forward (5′-3′) Reverse (5′-3′)
KNG1 CCTTTGGAATGGTGATACCG CGCAAATCTTGGTAGGTGGT
CCR9 CACTGTCCTGACCGTCTTTGTCT CTTCAAGCTTCCCTCTCTCCTTG
OPRM1 ACTGATCGACTTGTCCCACTTAGATGGC ACTGACTGACTGACCATGGGTCGGACAGGT
MTNR1A GGTGTATCGGAACAAGAAGCTC ACTGACTTGGCAGTGCAGATA
NPBWR1 CCGGGATCCACCATGGACAACGCCTCGTTCTCG CTAGTCTAGATCAGGCTGCCGCGCGGCAAGT
RXFP3 GGCAAGGCCATGTGTAAGATC CGTTGAACTTGATGAGGATGCTCCAG
KRT1 GTAAAACGACGGCCAG CAGGAAACAGCTATGAC
SSTR4 CCAGATGAAGACGGCTACCACC CACGTAGAAAGGCATCCAGCAGAG
VEGF TCACAGGTACAGGGATGAGGACAC CAAAGCACAGCAATGTCCTGAAG
CyclinD1 ACCTGAGGAGCCCCAACAA TCTGCTCCTGGCAGGCC
ki67 CCATATGCCTGTGGAGTGGAA CCACCCTTAGCGTGCTCTTGA
Caspase-3 CTTCAGTGGTGGACATGACG TCAACAATTTGAGGCTGCTG
Caspase-9 AGCCAGATGCTGTCCCATAC CAGGAACCGCTCTTCTTGTC
XIAP GAAGACCCTTGGGAACAACA CGCCTTAGCTGCTCTTCAGT
GAPDH CGGAGTCAACGGATTTGGTCGTAT AGCCTTCTCCATGGTGGTGAAGAC