Skip to main content

Table 1 Primers list

From: miR-22/KAT6B axis is a chemotherapeutic determiner via regulation of PI3k-Akt-NF-kB pathway in tongue squamous cell carcinoma

Gene Forward primer (5′- to 3′) Reverse primer (5′- to 3′)
C17orf91 CAAGTAGGGGAGGTGGGTTG CTTCCTGTAGCCGCTAGGTG
EGF TGTCCACGCAATGTGTCTGAA CATTATCGGGTGAGGAACAACC
HGF CAGCCCTGGAGTTCCATGATA CCATTGCAGGTCATGCATTC
PDGF1 GTGAGGTTAGAGGAGCATTTGGA CACATCTGGTTGGCTGCTTTAG
VEGF GCCTCCGAAACCATGAACTTT GACATCCATGAACTTCACCACTTC
IL-6 CCACTCACCTCTTCAGAACGAA CAGTGCCTCTTTGCTGCTTTC
FGF2 AAGCGGCTGTACTGCAAAAAC TCTCTCTTCTGCTTGAAGTTGTAGCT
CXCL3 GCCCCTGGCCACTGAACT CAAGCTTTCTGCCCATTCTTG
S100A8 GCTGGAGAAAGCCTTGAACTCTAT TGAGGACACTCGGTCTCTAGCA
S100A9 CAAAGAGCTGGTGCGAAAAGA TCGAAGCTCAGCTGCTTGTC
IGF1 GCTCTTCAGTTCGTGTGTGGA GCCTCCTTAGATCACAGCTCC
CXCL1 CGCCCAAACCGAAGTCATAG CAGCCACCAGTGAGCTTCCT
CXCL3 GGGACAGCTGGAAAGGACTTAA CAGGACTGAGCTATGTTTGATGAAA
CCL11 TCTGTGCCGACCCCAAGA TGCATTGTAAGAAGGGAAAACAAA
GAPDH ATTCCATGGCACCGTCAAGGCTGA TTCTCCATGGTGGTGAAGACGCCA