Skip to main content

Table 1. InitrogenTM sequences employed for gene expression studies

From: Inhibitory effects of low intensity pulsed ultrasound on osteoclastogenesis induced in vitro by breast cancer cells

Gene Forward primer sequence (5′-3′) Reverse primer sequence (3′-5′)
Gapdh CCCAGAAGACTGTGGATGG CAGATTGGGGGTAGGAACAC
Acp5 GCGACCATTGTTAGCCACATACG CGTTGATGTCGCACAGAGGGAT
Ctsk GCGTTGTTCTTATTCCGAGC CAGCAGAGGTGTGTACTATG
Mmp9 GCTGACTACGATAAGGACGGCA GCGGCCCTCAAAGATGAACGG