Skip to main content

Table 1 List of primers used in this study

From: The epigenetically downregulated factor CYGB suppresses breast cancer through inhibition of glucose metabolism

PCR Primer Sequence (5′-3′) Product size (bp) PCR cycles Annealing temperature (°C)
RT-PCR CYGB-F CTTCAGCCAGTTCAAGCACA 194 35 55
CYGB-R AGTACACCGGTTCCACCTTG
GAPDH-F GGAGTCAACGGATTTGGT 206 23 55
GAPDH-R GTGATGGGATTTCCATTGAT
qRT-PCR HXK2-F CCAGCTTTTGACCACATTGC 181 40 60
HXK2-R GTCTCTGCCTTCCACTCCACT
TIGAR-F GCAGCAGCTGCTGGTATAT 241 40 60
TIGAR-R GTGTAAACACAGGGCACTCT
PGM1-F CAGAGCAGCGCCAACTACG 222 40 60
PGM1-R AATGATGCAGGATACAGCAGGG
GLUT1-F TCACTGTGCTCCTGGTTCTG 135 40 60
GLUT1-R GCTCCTCGGGTGTCTTGT
β-actin-F GTCTTCCCCTCCATCGTG 113 40 60
β-actin-R AGGGTGAGGATGCCTCTCTT
MSP bCYGB-M1 GAGGTCGATCGTTAGTTCGTTC 118 40 60
bCYGB-M2 CAACGACTAACTCGAAAACGCG
bCYGB-U1 GTGAGGTTGATTGTTAGTTTGTTT 120 40 58
bCYGB-U2 CCCAACAACTAACTCAAAAACACA
  1. RT-PCR Reverse transcription-PCR, qRT-PCR Quantitative reverse transcription-PCR, MSP Methylation-specific PCR