Skip to main content

Table 1 Primers used for RT-qPCR

From: FXR1 promotes the malignant biological behavior of glioma cells via stabilizing MIR17HG

Primer or Probe Gene Sequence (5′- > 3′) or Assay ID
Primer MIR17HG F: TCAGGAGTTCGAGACCAACC
R: TGCCTCAGCCTCCAGAGTAG
TAL1 F: GCCTGGAACGTGAGTGGG
R: GGATAGTCCCGGGCGTTTTT
Probe GAPDH
miR-346
miR-425-5p
U6
F: ACAGTCAGCCGCATCTTCTT
R: GCCCAATACGACCAAATCC
4,373,038
4,380,926
4,395,470