Skip to main content

Table 2 Primers used for ChIP experiments

From: FXR1 promotes the malignant biological behavior of glioma cells via stabilizing MIR17HG

Gene

Binding site or Control

Sequence (5′- > 3′)

Product size (bp)

Annealing temperature (°C)

MIR17HG

PCR1

F: TGTTTATGAGGTTCTTTCCGAGC

160

59.2

R: GTGTTTCCTTAACCTGGCCG

  

PCR2

F: TGCTTGTATGTCAGATTTCCACA

168

58.6

R: TCACACTCTCTGAATCATGGGA

  

PCR3

F:CTGAGGGCTATATAGAACTGCTCTGACG

140

56

R:TGAAATGCCAAAGTGAGACACACAGC

  

DEC1

PCR1

F: CTTGACCAAAACTCCACAGTGA

102

58.2

R:AGTTGCAAATGTTACCAAATTTACAA

  

PCR2

F: TGCTTCTCTGAATGAGGTGAACT

138

59.8

R: AGGTTTCTCAGTGCTTACAACCA

  

PCR3

F: GCTAACAAAACCCAATTTCTTCTGG

186

59.6

R: TCCTCAGCAGACATATGGCC

  

PCR4

F:CATTCTATCCTCTGATCCCTGGAACC

184

56

R: CACTTACTCTGCGCCACGTTCTG