Skip to main content

Table 2 Primers used for ChIP experiments

From: FXR1 promotes the malignant biological behavior of glioma cells via stabilizing MIR17HG

Gene Binding site or Control Sequence (5′- > 3′) Product size (bp) Annealing temperature (°C)
MIR17HG PCR1 F: TGTTTATGAGGTTCTTTCCGAGC 160 59.2
R: GTGTTTCCTTAACCTGGCCG   
PCR2 F: TGCTTGTATGTCAGATTTCCACA 168 58.6
R: TCACACTCTCTGAATCATGGGA   
PCR3 F:CTGAGGGCTATATAGAACTGCTCTGACG 140 56
R:TGAAATGCCAAAGTGAGACACACAGC   
DEC1 PCR1 F: CTTGACCAAAACTCCACAGTGA 102 58.2
R:AGTTGCAAATGTTACCAAATTTACAA   
PCR2 F: TGCTTCTCTGAATGAGGTGAACT 138 59.8
R: AGGTTTCTCAGTGCTTACAACCA   
PCR3 F: GCTAACAAAACCCAATTTCTTCTGG 186 59.6
R: TCCTCAGCAGACATATGGCC   
PCR4 F:CATTCTATCCTCTGATCCCTGGAACC 184 56
R: CACTTACTCTGCGCCACGTTCTG