Skip to main content

Table 1 Primer sequences for reverse transcription quantitative polymerase chain reaction

From: RETRACTED ARTICLE: MicroRNA-506 inhibits tumor growth and metastasis in nasopharyngeal carcinoma through the inactivation of the Wnt/β-catenin signaling pathway by down-regulating LHX2

Gene Forward (5′-3′) Reverse (5′-3′)
miR-506 TAAGGCACCCTTCTGAGTAGA GCGAGCACAGAATTAATACGAC
LHX2 CCGCCGCGATGCTGTTCCACAGTC GAGTCATTAGAAAAGGTTGGTAAGAGTC
Wnt1 CCACCTCTTCGG CAAGA-TCGTCAA GTGGCATTTGCACTCTTGGCGCAT
β-catenin GCTGATTTGATGGAGTTGGA TCAGCTACTTGTTCTTGAGTGAA
TCF4 CCCAGGACCCTGAGCTACTT CTGGTGGCAACCCTGTAAGT
E-cadherin GAGCCTGAGTCCTGCAGTCC TGTATTGCTGCTTGGCCTCA
Vimentin GAAGAGAACTTTGCCGTTGAAG ACGAAGGTGACGAGCCATT
Twist GTCCGCAGTCTTACGAGGAG GCTTGAGGGTCTGAATCTTGCT
U6 TGACACGCAAATTCGTGAAGCGTTC CCAGTCTCAGGGTCCGAGGTATTC
GAPDH AGGTGAAGGTCGGAGTCAACG GCTCCTGGAAGATGGTGATGG
  1. Note: miR-506 MicroRNA-506, LHX2 LIM Homeobox 2, TCF4 Transcription factor 4, GAPDH Glyceraldehyde-3-phosphate dehydrogenase