Skip to main content

Advertisement

Table 1 Sequences of primers used for real-time PCR

From: GPAA1 promotes gastric cancer progression via upregulation of GPI-anchored protein and enhancement of ERBB signalling pathway

Primer Sequence 5′-3′
GPAA1 Forward CTCCCGCTTCGTCTCCATC
GPAA1 Reverse CACTGGCAGGACATAGAGGG
P21 Forward CGATGGAACTTCGACTTTGTCA
P21 Reverse GCACAAGGGTACAAGACAGTG
P27 Forward ATCACAAACCCCTAGAGGGCA
P27 Reverse GGGTCTGTAGTAGAACTCGGG
CyclinB1 Forward AATAAGGCGAAGATCAACATGGC
CyclinB1 Reverse TTTGTTACCAATGTCCCCAAGAG
CyclinD1 Forward CAATGACCCCGCACGATTTC
CyclinD1 Reverse CATGGAGGGCGGATTGGAA
CDK4 Forward TCAGCACAGTTCGTGAGGTG
CDK4 Reverse GTCCATCAGCCGGACAACAT
CDK6 Forward CCAGATGGCTCTAACCTCAGT
CDK6 Reverse AACTTCCACGAAAAAGAGGCTT
GAPDH Forward CTGGGCTACACTGAGCACC
GAPDH Reverse AAGTGGTCGTTGAGGGCAATG