Skip to main content

Table 1 Primer Sequences Used for Quantitative Real-time Polymerase Chain Reaction

From: FAM83H is involved in stabilization of β-catenin and progression of osteosarcomas

Gene Primer Sequence Product size Accession number
FAM83H forward CATGGTCCAGACAACCTGTG 214 NM_198488.3
reverse GCTGGATACCAGGAGGACAA   
CTNNB1 (β-catenin) forward AAAATGGCAGTGCGTTTAG 100 NM_001904.3
reverse TTTGAAGGCAGTCTGTCGTA   
CCND1 (Cyclin D1) forward GAGGAAGAGGAGGAGGAGGA 236 NM_053056.2
reverse GAGATGGAAGGGGGAAAGAG   
p27 forward TCTACTGCGTGGCTTGTCAG 240 AB001740.1
reverse CTGTATTTGGAGGCACAGCA   
Vimentin forward GAGAACTTTGCCGTTGAAGC 170 NM_003380.3
reverse TCCAGCAGCTTCCTGTAGGT   
SNAL1 (Snail) forward ACCCCACATCCTTCTCACTG 217 NM_005985.3
reverse TACAAAAACCCACGCAGACA   
GAPDH forward AACAGCGACACCCACTCCTC 258 NM_001256799.1
reverse GGAGGGGAGATTCAGTGTGGT   
  1. Web link to accession numbers: https://www.ncbi.nlm.nih.gov/gene