Skip to main content

Table 1 The characteristics of the primers used for real-time PCR and plasmid sequence

From: Long noncoding RNA 00976 promotes pancreatic cancer progression through OTUD7B by sponging miR-137 involving EGFR/MAPK pathway

GeneSequence (5′ - > 3′)
Linc00976Forward PrimerCAGCAGTGTGAAGCAATG
Reverse PrimerACAAGTAGAGTCTATGGTTCC
OTUD7BForward PrimerGTCAGATTTTGTCCGTTCCACA
Reverse PrimerCATGGACTTGACGTAGCTGTT
CyclinD1Forward PrimerGCTGCGAAGTGGAAACCATC
Reverse PrimerCCTCCTTCTGCACACATTTGAA
CDK2Forward PrimerCCAGGAGTTACTTCTATGCCTGA
Reverse PrimerTTCATCCAGGGGAGGTACAAC
MMP2Forward PrimerTACAGGATCATTGGCTACACACC
Reverse PrimerGGTCACATCGCTCCAGACT
MMP9Forward PrimerTGTACCGCTATGGTTACACTCG
Reverse PrimerGGCAGGGACAGTTGCTTCT
ControlUUAUUGCUUAAGAAUACGCGUAG 
UCACAACCUCCUAGAAAGAGUAGA 
miR-137 inhibitorCTACGCGTATTCTTAAGCAATAA 
miR-137 mimicUUAUUGCUUAAGAAUACGCGUAG 
Si-Linc009765′-GTCAATTGCTCAAACCAAA-3’ 
Si-OTUD7BGCAAAGAUGAUAGUGACAATT 
 UUGUCACUAUCAUCUUUGCTT