Skip to main content

Table 1 Primer sequence

From: Correction to: Down-regulated lncRNA SBF2-AS1 inhibits tumorigenesis and progression of breast cancer by sponging microRNA-143 and repressing RRS1

GenePrimer sequence (5′ → 3′)
miR-143F: TGAGATGAAGCACTGTAGCTC
R: GCGAGCACAGAATTAATACGAC
U6F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT
SBF2-AS1F: GGGATGGACTGACAAAAC
R: CATCCACAGATGTACCATG
RRS1F: CCCTACCGGACACCAGAGTAA
R: CCGAAAAGGGGTTGAAACTTCC
GAPDHF: CCACATCGCTCAGACACCAT
R: ACCAGGCGCCCAATACG