Skip to main content

Table 1 Sequences of shRNA template

From: SRSF10 inhibits biogenesis of circ-ATXN1 to regulate glioma angiogenesis via miR-526b-3p/MMP2 pathway

Gene   Sequence(5’->3’)
SRSF10 Sence GATCCgctgaagacgctttacataatTTCAAGAGA
attatgtaaagcgtcttcagcTTTTTTGCTAGCG
Antisence AATTCGCTAGCAAAAAAgctgaagacgctttacataat
TCTCTTGAAattatgtaaagcgtcttcagcG
NC Sence CACCGTTCTCCGAACGTGTCACGTCAAGA
GATTACGTGACACGTTCGGAGAATTTTTTG
Antisence GATCCAAAAAATTCTCCGAACGTGTCACGT
AATCTCTTGACGTGACACGTTCGGAGAAC
Circ-ATXN1 Sence CACCAACAGTGCCAATTGCACATCCTCAAG
AGGGATGTGCAATTGGCACTGTTTTTTTTG
Antisence GATCCAAAAAAAACAGTGCCAATTGCACTC
CCTCTTGAGGATGTGCAATTGGCACTGTT