Skip to main content

Table 2 Primer and probes used for RT-qPCR

From: SRSF10 inhibits biogenesis of circ-ATXN1 to regulate glioma angiogenesis via miR-526b-3p/MMP2 pathway

Primer or Probe Gene Sequence(5’->3’) or Assay ID
Primer SRSF10 F:CCAGGGGGATCGAAAGACAC
R:GTGGTCTTCCAGTCGGTCTAC
Circ-ATXN1 F:GTGCTTGCAGGTTTTCTAGGTAG
R:GTGGGTACAATCCGCCAAC
P:FAM+AGCTCTGGATGTGCAATTGGCACTG+BHQ1
GAPDH F:GGACCTGACCTGCCGTCTAG
R:TAGCCCAGGATGCCCTTGAG
P:FAM+CCTCCGACGCCTGCTTCACCACCT+Eclipse
Probe miR-526-3p 002383 (Applied biosystems)
U6 001973 (Applied biosystems)