Skip to main content

Table 2 Primer sequence for reverse transcription quantitative polymerase chain reaction

From: Human umbilical cord mesenchymal stem cells-derived exosomes deliver microRNA-375 to downregulate ENAH and thus retard esophageal squamous cell carcinoma progression

Gene Primer sequence (5′ - 3′)
miR-375 F: AGCCGTTTGTTCGTTCGGCT
R: GTGCAGGGTCCGAGGT
ENAH F: TCAAGGGTAAGGGAAACTGG
R: TGGCTCACAAGTGGTCCTCC
U6 F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT
GAPDH F: CTCCTCCTGTTCGACAGTCAGC
R: CCCAATACGACCAAATCCGTT
  1. Notes: F, forward; R, reverse; miR-375, microRNA-375; ENAH, enabled homolog; GAPDH, glyceraldehyde-3-phosphate dehydrogenase